ID: 934525346_934525364

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 934525346 934525364
Species Human (GRCh38) Human (GRCh38)
Location 2:95048395-95048417 2:95048445-95048467
Sequence CCCACACCACCTGTACCCGCCAG CAAGGGCTGTTTTCACCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 135} {0: 1, 1: 0, 2: 1, 3: 12, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!