ID: 934542562_934542572

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 934542562 934542572
Species Human (GRCh38) Human (GRCh38)
Location 2:95188215-95188237 2:95188263-95188285
Sequence CCTTCTCCATATTCCACTGCTCT CAAGAACACCAGGTCCACATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!