ID: 934546202_934546207

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 934546202 934546207
Species Human (GRCh38) Human (GRCh38)
Location 2:95218784-95218806 2:95218820-95218842
Sequence CCCTCTCACTGTGTTCTCACATG GCATAGGTGTGGAGAGAAATTGG
Strand - +
Off-target summary {0: 29, 1: 305, 2: 831, 3: 1774, 4: 2776} {0: 1, 1: 0, 2: 4, 3: 28, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!