ID: 934547307_934547311

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 934547307 934547311
Species Human (GRCh38) Human (GRCh38)
Location 2:95228758-95228780 2:95228802-95228824
Sequence CCTGGTGGTTTTCTTTTTTTAAT TTGGGCCCCCAAAATCATTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 242, 4: 2211} {0: 3, 1: 32, 2: 58, 3: 52, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!