ID: 934556423_934556426

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 934556423 934556426
Species Human (GRCh38) Human (GRCh38)
Location 2:95289234-95289256 2:95289249-95289271
Sequence CCCTGAGGCTGCCTGTCCTCCCC TCCTCCCCTTTGATTTAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 63, 4: 515} {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!