ID: 934563173_934563181

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 934563173 934563181
Species Human (GRCh38) Human (GRCh38)
Location 2:95323639-95323661 2:95323660-95323682
Sequence CCCACCCCGTCACAACTTTGGGG GGCTTAAAGGCACCAGGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 81} {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!