ID: 934566983_934567001

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 934566983 934567001
Species Human (GRCh38) Human (GRCh38)
Location 2:95346617-95346639 2:95346657-95346679
Sequence CCCCCGCGCCCCGGCGCCCGCGG CAGAGGCGCAGCGCCCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 132, 4: 704} {0: 1, 1: 0, 2: 4, 3: 17, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!