ID: 934567066_934567082

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 934567066 934567082
Species Human (GRCh38) Human (GRCh38)
Location 2:95346886-95346908 2:95346929-95346951
Sequence CCGCCTGCCGGGGGCATGTGAGC CGTGCGGGCTGCAGGGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165} {0: 1, 1: 0, 2: 1, 3: 47, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!