ID: 934572833_934572844

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 934572833 934572844
Species Human (GRCh38) Human (GRCh38)
Location 2:95383276-95383298 2:95383321-95383343
Sequence CCTGGAGGCCTGTCAGAAGGTAG AGTTCTCTGCAGGCTCTACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 166} {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!