ID: 934616199_934616208

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 934616199 934616208
Species Human (GRCh38) Human (GRCh38)
Location 2:95772775-95772797 2:95772809-95772831
Sequence CCTCATGGAGGCAGTTCTCTTCC CCAGGCAGGAGAGGCTGCTGAGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 5, 3: 107, 4: 991}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!