|
Left Crispr |
Right Crispr |
| Crispr ID |
934616202 |
934616208 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:95772796-95772818
|
2:95772809-95772831
|
| Sequence |
CCCCCACTTTCTGCCAGGCAGGA |
CCAGGCAGGAGAGGCTGCTGAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 3, 1: 1, 2: 5, 3: 107, 4: 991} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|