ID: 934618140_934618150

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 934618140 934618150
Species Human (GRCh38) Human (GRCh38)
Location 2:95787913-95787935 2:95787959-95787981
Sequence CCAGGTGATATACAGGAGAAAGG CCTGCCCCCAGCCACAGGGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 7, 3: 61, 4: 625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!