ID: 934638143_934638151

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 934638143 934638151
Species Human (GRCh38) Human (GRCh38)
Location 2:96009729-96009751 2:96009769-96009791
Sequence CCAGATACCTTTCCTTAGACAGG CTCAAATAGAAGTCGGGCCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!