ID: 934642743_934642753

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 934642743 934642753
Species Human (GRCh38) Human (GRCh38)
Location 2:96036600-96036622 2:96036646-96036668
Sequence CCCTCCCTGTGGCTGGGGGCAGG CCTTTCTCCTGTATATCACCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 7, 3: 61, 4: 625} {0: 2, 1: 0, 2: 1, 3: 26, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!