ID: 934646078_934646086

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 934646078 934646086
Species Human (GRCh38) Human (GRCh38)
Location 2:96060093-96060115 2:96060112-96060134
Sequence CCACCCTGGATACCCTGCCCTCC CTCCAGTAGCAGCCAGGTTCCGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 3, 3: 59, 4: 505} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!