ID: 934655135_934655141

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 934655135 934655141
Species Human (GRCh38) Human (GRCh38)
Location 2:96113374-96113396 2:96113392-96113414
Sequence CCCCATCAGCATTGCGGGGAGCA GAGCAGCGTGGCTGGGTCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96} {0: 1, 1: 0, 2: 0, 3: 13, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!