ID: 934655706_934655709

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 934655706 934655709
Species Human (GRCh38) Human (GRCh38)
Location 2:96116053-96116075 2:96116069-96116091
Sequence CCAGAGCGTTGCCGAAGATGGTA GATGGTAAAGAGAATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40} {0: 1, 1: 1, 2: 7, 3: 65, 4: 713}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!