ID: 934678462_934678469

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 934678462 934678469
Species Human (GRCh38) Human (GRCh38)
Location 2:96266045-96266067 2:96266068-96266090
Sequence CCCCGCGCGCGTCACAGCCTGGG CGCGCCGCCGGCTCTGCGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74} {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!