ID: 934714809_934714818

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 934714809 934714818
Species Human (GRCh38) Human (GRCh38)
Location 2:96537325-96537347 2:96537346-96537368
Sequence CCCTTTCCTCTGCGGCCGCCGTT TTTCCTGAAAGGGGCTGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100} {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!