ID: 934723163_934723175

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 934723163 934723175
Species Human (GRCh38) Human (GRCh38)
Location 2:96596207-96596229 2:96596250-96596272
Sequence CCCCACTTTTCTAAATTTCCCCC CTCTGAGAATGTAGTAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 334} {0: 1, 1: 0, 2: 2, 3: 14, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!