ID: 934748655_934748668

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 934748655 934748668
Species Human (GRCh38) Human (GRCh38)
Location 2:96777263-96777285 2:96777314-96777336
Sequence CCCGCCTCGGCCTCCCAAAGTGC CGGCCTGTTGCCTGTTTTCTAGG
Strand - +
Off-target summary {0: 84291, 1: 218536, 2: 234154, 3: 158283, 4: 172560} {0: 1, 1: 0, 2: 1, 3: 15, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!