ID: 934751575_934751589

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 934751575 934751589
Species Human (GRCh38) Human (GRCh38)
Location 2:96797375-96797397 2:96797413-96797435
Sequence CCCAGGACCCTGCCAGCCAGAGC GGGACTAGGGGCTGGAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 402} {0: 1, 1: 0, 2: 7, 3: 89, 4: 816}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!