ID: 934752564_934752573

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 934752564 934752573
Species Human (GRCh38) Human (GRCh38)
Location 2:96802937-96802959 2:96802989-96803011
Sequence CCATCAGGAGCAGCACCAGCATC AAAACCCGTCACCTCAGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 84, 4: 785} {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!