ID: 934759011_934759019

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 934759011 934759019
Species Human (GRCh38) Human (GRCh38)
Location 2:96843262-96843284 2:96843279-96843301
Sequence CCCTGCCATTTGCCTCCCGCCAG CGCCAGAGGCTGCACCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 236} {0: 1, 1: 0, 2: 1, 3: 30, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!