ID: 934763884_934763891

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 934763884 934763891
Species Human (GRCh38) Human (GRCh38)
Location 2:96869875-96869897 2:96869898-96869920
Sequence CCTATTGCGCGCAGCTCCAGTCC CCGGGCGCCGCCCTCGCGTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43} {0: 1, 1: 0, 2: 1, 3: 5, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!