ID: 934763982_934763985

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 934763982 934763985
Species Human (GRCh38) Human (GRCh38)
Location 2:96870185-96870207 2:96870200-96870222
Sequence CCCGCAGCGACCTGTGGACCCGC GGACCCGCCCGCTCTCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 86} {0: 1, 1: 0, 2: 1, 3: 14, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!