ID: 934765015_934765023

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 934765015 934765023
Species Human (GRCh38) Human (GRCh38)
Location 2:96875760-96875782 2:96875801-96875823
Sequence CCTGGGCCCCAGTGCTGTAACTG GAAACACAGGCAGAGGCATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 215} {0: 1, 1: 0, 2: 1, 3: 45, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!