ID: 934774379_934774382

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 934774379 934774382
Species Human (GRCh38) Human (GRCh38)
Location 2:96927799-96927821 2:96927828-96927850
Sequence CCCAGGAGGACACAGGGACACTC GCAGTCACAAGTGGCTCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 293} {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!