ID: 934791349_934791352

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 934791349 934791352
Species Human (GRCh38) Human (GRCh38)
Location 2:97064651-97064673 2:97064670-97064692
Sequence CCAATTCCAAACCATAACTTTGT TTGTAAGTGCATAAAACTGAAGG
Strand - +
Off-target summary {0: 6, 1: 100, 2: 124, 3: 195, 4: 373} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!