ID: 934829899_934829901

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 934829899 934829901
Species Human (GRCh38) Human (GRCh38)
Location 2:97508260-97508282 2:97508286-97508308
Sequence CCTTCAGTCTGCATATTGTTCAT TACTTTTGTGCTGTAATTGCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 3, 3: 27, 4: 195} {0: 2, 1: 1, 2: 4, 3: 18, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!