ID: 934843628_934843633

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 934843628 934843633
Species Human (GRCh38) Human (GRCh38)
Location 2:97647075-97647097 2:97647088-97647110
Sequence CCCACTGATGAAGAGCAGGCGAC AGCAGGCGACTGGGTTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61} {0: 1, 1: 2, 2: 5, 3: 18, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!