ID: 934846334_934846346

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 934846334 934846346
Species Human (GRCh38) Human (GRCh38)
Location 2:97663600-97663622 2:97663631-97663653
Sequence CCGCCCGACTCGGGGAGGGGTCG GCTCTGCGACGCGGGCGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 60} {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!