ID: 934853740_934853752

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 934853740 934853752
Species Human (GRCh38) Human (GRCh38)
Location 2:97716690-97716712 2:97716723-97716745
Sequence CCCGTGTGGCTGGAGGGGAGTGA GTGGTGATGGGCATCATGAAGGG
Strand - +
Off-target summary {0: 1, 1: 35, 2: 126, 3: 407, 4: 1149} {0: 1, 1: 0, 2: 0, 3: 19, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!