ID: 934874905_934874912

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 934874905 934874912
Species Human (GRCh38) Human (GRCh38)
Location 2:97908557-97908579 2:97908571-97908593
Sequence CCTTCTTCACCAAAATGAGCAAG ATGAGCAAGGGGAAAGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 255} {0: 1, 1: 1, 2: 6, 3: 106, 4: 962}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!