ID: 934892501_934892508

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 934892501 934892508
Species Human (GRCh38) Human (GRCh38)
Location 2:98083005-98083027 2:98083049-98083071
Sequence CCCTAATTCTTTTAATGTTAAAC TTCTTCACTCCTCAAGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 561} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!