ID: 934899494_934899497

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 934899494 934899497
Species Human (GRCh38) Human (GRCh38)
Location 2:98146704-98146726 2:98146728-98146750
Sequence CCCTTATCAGTATGTTATTTTTG CTCCTAGTTTAGAGGAAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 528} {0: 1, 1: 0, 2: 1, 3: 14, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!