ID: 934913192_934913198

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 934913192 934913198
Species Human (GRCh38) Human (GRCh38)
Location 2:98277471-98277493 2:98277506-98277528
Sequence CCCAGAAAGATCAAAAAGGCTCT CTTGACTGCTTTGGAAAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 271} {0: 1, 1: 0, 2: 0, 3: 16, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!