ID: 934954603_934954607

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 934954603 934954607
Species Human (GRCh38) Human (GRCh38)
Location 2:98607256-98607278 2:98607279-98607301
Sequence CCAGGAGCTGGCTGAACGGCAGC ACCAGTGAGTAAGGGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179} {0: 1, 1: 0, 2: 2, 3: 20, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!