ID: 934965434_934965440

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 934965434 934965440
Species Human (GRCh38) Human (GRCh38)
Location 2:98717450-98717472 2:98717481-98717503
Sequence CCATGGGATCCTAGATTGGACTC AAGGACATTAGTGGGAACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72} {0: 1, 1: 1, 2: 14, 3: 82, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!