ID: 934983572_934983579

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 934983572 934983579
Species Human (GRCh38) Human (GRCh38)
Location 2:98868319-98868341 2:98868365-98868387
Sequence CCGTTCGCCCAGCTCAAGTGATG CTGACAGAGACTGCCCTACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 172} {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!