ID: 934990827_934990831

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 934990827 934990831
Species Human (GRCh38) Human (GRCh38)
Location 2:98920464-98920486 2:98920483-98920505
Sequence CCAGGGCTGTCACCACCAAGGGG GGGGTGCCAGCACTTTCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 212} {0: 1, 1: 0, 2: 0, 3: 23, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!