ID: 935014635_935014637

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 935014635 935014637
Species Human (GRCh38) Human (GRCh38)
Location 2:99168993-99169015 2:99169011-99169033
Sequence CCAAGCTCCATCTGTCTCTTTAA TTTAAAAGCACTCTAATCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 376} {0: 1, 1: 0, 2: 1, 3: 19, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!