ID: 935037124_935037129

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 935037124 935037129
Species Human (GRCh38) Human (GRCh38)
Location 2:99388356-99388378 2:99388399-99388421
Sequence CCTTATTCCTGATATTAAGGGAA TAAGTATGATGTCAGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 15, 3: 112, 4: 537} {0: 1, 1: 8, 2: 21, 3: 101, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!