ID: 935044804_935044807

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 935044804 935044807
Species Human (GRCh38) Human (GRCh38)
Location 2:99471289-99471311 2:99471316-99471338
Sequence CCCAGGGTCATCTGTGTTTAAAA CTCTTCATGACCATTCAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 279} {0: 1, 1: 0, 2: 1, 3: 16, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!