ID: 935071810_935071815

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 935071810 935071815
Species Human (GRCh38) Human (GRCh38)
Location 2:99700982-99701004 2:99701001-99701023
Sequence CCCGGGGAACACTCCACACTCAT TCATACTGAAAGGGACAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134} {0: 1, 1: 0, 2: 2, 3: 22, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!