ID: 935085208_935085212

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 935085208 935085212
Species Human (GRCh38) Human (GRCh38)
Location 2:99838157-99838179 2:99838186-99838208
Sequence CCGACTCTGGGGAGCATTTTAAG AGATGCTGTGTGGGTCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 179} {0: 1, 1: 0, 2: 1, 3: 31, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!