ID: 935088416_935088420

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 935088416 935088420
Species Human (GRCh38) Human (GRCh38)
Location 2:99870510-99870532 2:99870533-99870555
Sequence CCCTGCTGGATCTACCCATGCAG ACCCCACCCCTGTGATCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 218} {0: 1, 1: 0, 2: 1, 3: 21, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!