ID: 935095004_935095006

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 935095004 935095006
Species Human (GRCh38) Human (GRCh38)
Location 2:99935834-99935856 2:99935864-99935886
Sequence CCACTTAAAGGAGCTAGGAGAGT CAGAGTCCCCAGCGACATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111} {0: 1, 1: 0, 2: 0, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!