ID: 935112484_935112494

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 935112484 935112494
Species Human (GRCh38) Human (GRCh38)
Location 2:100105353-100105375 2:100105402-100105424
Sequence CCCGCAAGTTCAGCGAAATAAAG CCCGGACCTGCTCTCCGTTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111} {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!