ID: 935121742_935121747

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 935121742 935121747
Species Human (GRCh38) Human (GRCh38)
Location 2:100189080-100189102 2:100189101-100189123
Sequence CCACACTGGCTGCCCCATTTTAC ACATTCCCACCCATAGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 154, 3: 613, 4: 2050} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!